Details of Primer Pair 'ABC09717_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09717_L01R01419Nils Rostoks2004-01-26 ABC09717_L01 TTCAAGATAAAGGGCGGCGA 936 20 Nils Rostoks 2004-01-26 Illumina
ABC09717_R01 TCCCAAACTTCTGATGACGGC 1354 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09717_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes