Details of Primer Pair 'ABC09877_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09877_L01R01447Nils Rostoks2004-01-26 ABC09877_L01 CCAGCATGGACCCGACCTAC 890 20 Nils Rostoks 2004-01-26 Illumina
ABC09877_R01 AGAGAGAGGACGGTGGGGCT 1336 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09877_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes