Details of Primer Pair 'ABC09920_L02R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09920_L02R02413Nils Rostoks2004-05-27 ABC09920_L02 CGTGGCTCAGCTCCTCCTGT 1013 20 Nils Rostoks 2004-05-27 Qiagen
ABC09920_R02 TCCTGGGCTGAGGCAAAAAG 1426 20 Nils Rostoks 2004-05-27 Qiagen

Details of Primer Pair 'ABC09920_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09920_L01R01405Nils Rostoks2004-01-26 ABC09920_L01 CCTGTGGACAGTGTGGGCTG 1027 20 Nils Rostoks 2004-01-26 Illumina
ABC09920_R01 AAAACCTCCTGGGCTGAGGC 1431 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09920_L02R02'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined

Comment History of 'ABC09920_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes