Details of Primer Pair 'ABC10148_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10148_L01R01178Nils Rostoks2005-03-17 ABC10148_L01 AAGCAGCAAAGCAAAGTACC 941 20 Nils Rostoks 2005-03-17 Invitrogen
ABC10148_R01 TCATCAGCATCTGATCATCC 763 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC10148_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB