Details of Primer Pair 'ABC10157_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10157_L01R01430Nils Rostoks2004-01-26 ABC10157_L01 TGCTTGTCAATGGTGCCGAT 842 20 Nils Rostoks 2004-01-26 Illumina
ABC10157_R01 CCCGTTGCTTATCCAAGGCA 1271 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10157_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes