Details of Primer Pair 'ABC10197_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10197_L01R01400Nils Rostoks2004-01-26 ABC10197_L01 GAGATTTCGCCCCAACATCG 885 20 Nils Rostoks 2004-01-26 Illumina
ABC10197_R01 TTCCGGTGTTGAAAGGCAGG 1284 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10197_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes