Details of Primer Pair 'ABC10226_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10226_L01R01186Nils Rostoks2005-03-17 ABC10226_L01 TTCCAAGAGAAAGTGCATGG 136 20 Nils Rostoks 2005-03-17 Invitrogen
ABC10226_R01 ACATCGCCAGTATGTTTTCC 322 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC10226_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB