Details of Primer Pair 'ABC10254_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10254_L01R01416Nils Rostoks2004-01-26 ABC10254_L01 AATTTGCCCGGAGGATGGTT 931 20 Nils Rostoks 2004-01-26 Illumina
ABC10254_R01 CGCTCTGCTCAGTCCACCAA 1346 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10254_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes