Details of Primer Pair 'ABC10263_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10263_L01R01429Nils Rostoks2004-01-26 ABC10263_L01 GTGGGTGTTACGCGAGGGTG 212 20 Nils Rostoks 2004-01-26 Illumina
ABC10263_R01 GTCGACGGAGCATACGGGAC 640 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10263_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes