Details of Primer Pair 'ABC10311_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10311_L01R01636Nils Rostoks2004-05-27 ABC10311_L01 CCTCCAAGCCATCTCCAACG 216 20 Nils Rostoks 2004-05-27 Qiagen
ABC10311_R01 TGCAATTCTCATAGTAGGCAAGCTG 852 25 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC10311_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined