Details of Primer Pair 'ABC10361_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10361_L01R01442Nils Rostoks2004-01-26 ABC10361_L01 CAGGTGCCATAAGATCGCCA 501 20 Nils Rostoks 2004-01-26 Illumina
ABC10361_R01 CTCATCCACCAGCTCTGGCA 942 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10361_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes