Details of Primer Pair 'ABC10400_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10400_L01R01431Nils Rostoks2004-01-26 ABC10400_L01 ATACATGCCAGCGGCGTCTT 743 20 Nils Rostoks 2004-01-26 Illumina
ABC10400_R01 ATCGATGCGCAGGGATCAAG 1173 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10400_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes