Details of Primer Pair 'ABC10441_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10441_L01R01415Nils Rostoks2004-01-26 ABC10441_L01 CCCAGCCTGCACACAACACT 493 20 Nils Rostoks 2004-01-26 Illumina
ABC10441_R01 CCAGCAGCAAACAATGGTGC 907 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10441_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes