Details of Primer Pair 'ABC10472_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10472_L01R01417Nils Rostoks2004-01-26 ABC10472_L01 AGCAGCTGGTCAGCTAGGCG 616 20 Nils Rostoks 2004-01-26 Illumina
ABC10472_R01 ACCACACGCACACGGACAGT 1032 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10472_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes