Details of Primer Pair 'ABC10477_L02R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10477_L02R02150Nils Rostoks2005-03-17 ABC10477_L02 AGAGCAATGAGCTCCTACCC 1494 20 Nils Rostoks 2005-03-17 Invitrogen
ABC10477_R02 GCTTACTCGCTCGTTTAGTCG 1344 21 Nils Rostoks 2005-03-17 Invitrogen

Details of Primer Pair 'ABC10477_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10477_L01R01453Nils Rostoks2004-01-26 ABC10477_L01 CAACATGTTCGACGCGATCC 914 20 Nils Rostoks 2004-01-26 Illumina
ABC10477_R01 CCGCGACTAAACGAGCGAGT 1366 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10477_L02R02'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB

Comment History of 'ABC10477_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes