Details of Primer Pair 'ABC10632_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10632_L01R01434Nils Rostoks2004-01-26 ABC10632_L01 ATCCACCTCCACGGCTTCAA 597 20 Nils Rostoks 2004-01-26 Illumina
ABC10632_R01 CCATAAACACACGCGGCAAA 1030 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10632_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes