Details of Primer Pair 'ABC10636_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10636_L01R01549Nils Rostoks2004-01-26 ABC10636_L01 TCTGCCAAGGCTGAACTCCA 853 20 Nils Rostoks 2004-01-26 Illumina
ABC10636_R01 CCACGGTGCTCCTCTGTCCT 1401 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10636_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes