Details of Primer Pair 'ABC10667_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10667_L01R01417Nils Rostoks2004-01-26 ABC10667_L01 GAGTACTTCGGCGTGGACGG 267 20 Nils Rostoks 2004-01-26 Illumina
ABC10667_R01 TAACCATGCCTCCCCCAGTG 683 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10667_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes