Details of Primer Pair 'ABC10705_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10705_L01R01403Nils Rostoks2004-01-26 ABC10705_L01 CCCACAGGGAACAAGTGCAA 829 20 Nils Rostoks 2004-01-26 Illumina
ABC10705_R01 TCGCGTTCTCCGAAGATGCT 1231 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10705_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes