Details of Primer Pair 'ABC10887_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10887_L01R01699Nils Rostoks2003-09-19 ABC10887_L01 ACCTTCACGAAGCCGCTGTT 1102 20 Nils Rostoks 2003-06-03 Invitrogen
ABC10887_R01 GGTGGTTGGGACGGTTGAGA 403 20 Nils Rostoks 2003-06-03 Invitrogen

Comment History of 'ABC10887_L01R01'

DateSubmitterComment
2003-09-19 Nils Rostoks L01+R01 worked fine.