Details of Primer Pair 'ABC10942_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC10942_L01R01403Nils Rostoks2004-01-26 ABC10942_L01 TGGAGATGTTGGCGTGGGAT 723 20 Nils Rostoks 2004-01-26 Illumina
ABC10942_R01 GCCCAAGCACCATCCTTGAC 1125 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC10942_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes