Details of Primer Pair 'ABC11085_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC11085_L01R01559Nils Rostoks2004-01-26 ABC11085_L01 CAATCACCTGAACGGGAGGG 518 20 Nils Rostoks 2004-01-26 Illumina
ABC11085_R01 AGGCAGCAGTTCAAGCTGGG 1076 20 Nils Rostoks 2004-01-26 Illumina

Details of Primer Pair 'ABC11085_L02R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC11085_L02R02460Nils Rostoks2004-05-27 ABC11085_L02 ACACGCCGAGCAAGATCTCC 350 20 Nils Rostoks 2004-05-27 Qiagen
ABC11085_R02 TCAGCATCAGCTCAACCGACA 810 21 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC11085_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes

Comment History of 'ABC11085_L02R02'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined