Details of Primer Pair 'ABC11129_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC11129_L01R01525Nils Rostoks2004-01-26 ABC11129_L01 ACGAAGCTGTGGCTGAAGGG 771 20 Nils Rostoks 2004-01-26 Illumina
ABC11129_R01 CGTGCATGACACAGTGCTGG 1295 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC11129_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes