Details of Primer Pair 'ABC11401_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC11401_L01R01445Nils Rostoks2004-01-26 ABC11401_L01 CAACCAGCAGTTCACCACCG 588 20 Nils Rostoks 2004-01-26 Illumina
ABC11401_R01 ACTTCTGCAGCTTGCCAGGG 1032 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC11401_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes