Details of Primer Pair 'ABC11529_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC11529_L01R01402Nils Rostoks2004-01-26 ABC11529_L01 CGTGTGGGTGCACGACTACC 1053 20 Nils Rostoks 2004-01-26 Illumina
ABC11529_R01 CCCCGACCACAGAACTGCTT 1454 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC11529_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes