Details of Primer Pair 'ABC11783_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC11783_L01R01438Nils Rostoks2004-01-26 ABC11783_L01 CACAGAGCACCTTTGCACGG 1305 20 Nils Rostoks 2004-01-26 Illumina
ABC11783_R01 GCACCAGGGCTTTCCTTCCT 1742 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC11783_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes