Details of Primer Pair 'ABC11913_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC11913_L01R01503Nils Rostoks2004-01-26 ABC11913_L01 ACGAGCTGTCAGACCCCGTC 577 20 Nils Rostoks 2004-01-26 Illumina
ABC11913_R01 CCCCACTCACACACCAATGC 1079 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC11913_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes