Details of Primer Pair 'ABC11935_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC11935_L01R01509Nils Rostoks2004-01-26 ABC11935_L01 GTACGCGGTGGAGTTGGGAC 515 20 Nils Rostoks 2004-01-26 Illumina
ABC11935_R01 GGGACGCATCGGTCTTGACT 1023 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC11935_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes