Details of Primer Pair 'ABC11984_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC11984_L01R01481Nils Rostoks2004-01-26 ABC11984_L01 GAAGTGGAGCGACATTGGCA 1214 20 Nils Rostoks 2004-01-26 Illumina
ABC11984_R01 CAACCCATGCCGGACCTTAG 1694 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC11984_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes