Details of Primer Pair 'ABC11989_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC11989_L01R01525Nils Rostoks2004-01-26 ABC11989_L01 GTGCCAGCCAACCTACCCAC 395 20 Nils Rostoks 2004-01-26 Illumina
ABC11989_R01 TTTGACGCACAACCTGCACA 919 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC11989_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes