Details of Primer Pair 'ABC12093_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC12093_L01R01461Nils Rostoks2004-01-26 ABC12093_L01 GCTGGCCATCACGATCCTCT 331 20 Nils Rostoks 2004-01-26 Illumina
ABC12093_R01 TATTTTGCAGGTCCGGCGAT 791 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC12093_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes