Details of Primer Pair 'ABC12121_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC12121_L01R01545Nils Rostoks2004-05-27 ABC12121_L01 CCCCCTCAAATCGTTCAAGTTCTAC 592 25 Nils Rostoks 2004-05-27 Qiagen
ABC12121_R01 ATCGGCTTCTTCAATCCCACAA 1137 22 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC12121_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined