Details of Primer Pair 'ABC12239_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC12239_L01R01406Nils Rostoks2004-01-26 ABC12239_L01 TCCTCTTCCTTGCCACCGAG 313 20 Nils Rostoks 2004-01-26 Illumina
ABC12239_R01 ACCATCCTTGCCTCGAGCTG 718 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC12239_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes