Details of Primer Pair 'ABC12277_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC12277_L01R01479Nils Rostoks2004-01-26 ABC12277_L01 GCGGATGTCTTCGACATGGA 1059 20 Nils Rostoks 2004-01-26 Illumina
ABC12277_R01 GAAACGCCTGCATCAGGACA 1537 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC12277_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes