Details of Primer Pair 'ABC12286_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC12286_L01R01469Nils Rostoks2004-01-26 ABC12286_L01 GGGCCAGCATCTTCACCAAG 1155 20 Nils Rostoks 2004-01-26 Illumina
ABC12286_R01 TAGCGGCCCATTTTGCTGTT 1623 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC12286_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes