Details of Primer Pair 'ABC12292_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC12292_L01R01404Nils Rostoks2004-01-26 ABC12292_L01 GAGCGACCTCGGAGTTGAGC 653 20 Nils Rostoks 2004-01-26 Illumina
ABC12292_R01 TGTACGTCGCCTCCCCTAGC 1056 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC12292_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes