Details of Primer Pair 'ABC12344_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC12344_L01R01189Nils Rostoks2005-03-17 ABC12344_L01 TTCCCTTCCCTCTTTCTTTC 228 20 Nils Rostoks 2005-03-17 Invitrogen
ABC12344_R01 AATTTACTGCATATCTTGTTCATATTG 39 27 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC12344_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB