Details of Primer Pair 'ABC12379_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC12379_L01R01438Nils Rostoks2004-01-26 ABC12379_L01 AAGCTTTTGCCAGCCGAGAA 806 20 Nils Rostoks 2004-01-26 Illumina
ABC12379_R01 GCTGGGTCGCATCTCTTCGT 1243 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC12379_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes