Details of Primer Pair 'ABC12417_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC12417_L01R01414Nils Rostoks2004-01-26 ABC12417_L01 AGCTGAAGCCCATCACCGAG 589 20 Nils Rostoks 2004-01-26 Illumina
ABC12417_R01 TCACGCACGCCTACGAGGTA 1002 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC12417_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes