Details of Primer Pair 'ABC12449_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC12449_L01R01426Nils Rostoks2004-01-26 ABC12449_L01 CAGCTTCCACAATGAGGCGA 1397 20 Nils Rostoks 2004-01-26 Illumina
ABC12449_R01 CCCATCCCATCTTCACCAGC 1822 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC12449_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes