Details of Primer Pair 'ABC12856_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC12856_L01R01435Nils Rostoks2004-01-26 ABC12856_L01 ACCCCCTTGCTGTTCTCACG 856 20 Nils Rostoks 2004-01-26 Illumina
ABC12856_R01 CACGCCCAAGAGGACAATCA 1290 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC12856_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes