Details of Primer Pair 'ABC12986_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC12986_L01R01435Nils Rostoks2004-01-26 ABC12986_L01 GGCCTACGCGCTCATCAAGT 660 20 Nils Rostoks 2004-01-26 Illumina
ABC12986_R01 GTTCCAATTTGCGCCTCTGC 1094 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC12986_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes