Details of Primer Pair 'ABC12999_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC12999_L01R01408Nils Rostoks2004-01-26 ABC12999_L01 TCGAGAGGATCACGGTGCTG 281 20 Nils Rostoks 2004-01-26 Illumina
ABC12999_R01 GGGTAACCAACCCCCACACA 688 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC12999_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes