Details of Primer Pair 'ABC13296_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC13296_L01R01447Nils Rostoks2004-01-26 ABC13296_L01 AGTAAACGGCGGGCAGATGA 975 20 Nils Rostoks 2004-01-26 Illumina
ABC13296_R01 TTGCACGCCAAGGTTAGCAC 1421 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC13296_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes