Details of Primer Pair 'ABC13318_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC13318_L01R01422Nils Rostoks2004-01-26 ABC13318_L01 GCAGTACTCCCGCACCGTCT 609 20 Nils Rostoks 2004-01-26 Illumina
ABC13318_R01 TTGCGGTGAAAAGAATGCCA 1030 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC13318_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes