Details of Primer Pair 'ABC13376_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC13376_L01R01544Nils Rostoks2004-01-26 ABC13376_L01 TGGCGATTCGGGATTACTGG 780 20 Nils Rostoks 2004-01-26 Illumina
ABC13376_R01 AGGCCAAGGGATTGGGTCAT 1323 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC13376_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes