Details of Primer Pair 'ABC13480_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC13480_L01R01448Nils Rostoks2004-01-26 ABC13480_L01 GTCTACAACGGCTACGGCGG 514 20 Nils Rostoks 2004-01-26 Illumina
ABC13480_R01 TGATCTTGCCACTGCCCAAA 961 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC13480_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes