Details of Primer Pair 'ABC13523_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC13523_L01R01534Nils Rostoks2004-01-26 ABC13523_L01 TAGAGGCGGCTGAGGCATTC 466 20 Nils Rostoks 2004-01-26 Illumina
ABC13523_R01 CGACGAAGACACTCCGCTCA 999 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC13523_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes