Details of Primer Pair 'ABC13561_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC13561_L01R01562Nils Rostoks2004-01-26 ABC13561_L01 TGCCAACAAGCTCCACCGTA 536 20 Nils Rostoks 2004-01-26 Illumina
ABC13561_R01 CCCTGAGCAAGGGGACACAT 1097 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC13561_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes