Details of Primer Pair 'ABC13569_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC13569_L01R01409Nils Rostoks2004-01-26 ABC13569_L01 ATATCAAGCATCCACGCCCG 949 20 Nils Rostoks 2004-01-26 Illumina
ABC13569_R01 GCACGAGATCCAAACACCTGC 1357 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC13569_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes